Graphical Abstract
INTRODUCTION
Metabolic dysfunction–associated steatotic liver disease (MASLD), previously known as nonalcoholic fatty liver disease (NAFLD), represents a spectrum of chronic liver conditions, ranging from metabolic dysfunction-associated steatotic liver (MASL) to more severe metabolic dysfunction-associated steatohepatitis (MASH), which can progress to cirrhosis and even hepatocellular carcinoma (HCC) [1-3]. A comprehensive meta-analysis revealed a global MASLD incidence of 32.4% [4]. MASLD is the leading cause of hepatic failure and transplantation worldwide [5]. MASLD is strongly associated with obesity, metabolic syndrome, and cardiovascular diseases [6-8]. The treatment of MASLD is still focused on improving lifestyle [9]. Although the Food and Drug Administration (FDA) has approved resmetirom for the treatment of individuals with MASLD, it is not likely that a single drug will yield satisfactory treatment efficacy because of the complex mechanisms involved in the development of MASLD [10,11]. Therefore, more promising therapeutic targets for MASLD are urgently needed.
MASLD is caused by excessive lipid accumulation within liver tissue [12]. An imbalance between lipid acquisition through fatty acid uptake or de novo lipogenesis and lipid disposal via fatty acid oxidation (FAO) or excretion causes this accumulation [13]. The lipotoxicity induced by excessive hepatic lipid accumulation is often associated with the promotion of an inflammatory response, which contributes to the pathogenesis of MASLD [14]. Fatty acids taken up into cells are first activated to fatty acyl-CoA by acyl-CoA synthetases and then directed into various metabolic pathways, such as lipid synthesis and fatty acid oxidation [15]. Fatty acid oxidation largely contributes to the disposal of excess hepatic lipids [16]. For example, long-chain acyl-CoA synthase 5 (ACSL5) alleviates MASLD progression by promoting fatty acid oxidation [17]. Increasing the oxidation of fatty acids, thereby preventing their accumulation in the liver, may be an effective strategy for treating individuals with MASLD.
Ubiquitin-specific protease 29 (USP29) is a member of the USP family of deubiquitinases, which play a key role in maintaining protein stability by removing ubiquitin chains from substrates [18]. Human USP29 is located on chromosome 19, is composed of 922 amino acids and contains a typical USP catalytic activity domain [19]. USP29 has been reported to play different regulatory roles in a variety of diseases, including liver disease [20]. For example, USP29 attenuates hepatic ischemia-reperfusion injury by preventing the activation of TAK1 through K63-linked polyubiquitination [21]. USP29 promotes sorafenib resistance in HCC cells by stabilizing HIF1α [22]. However, the underlying effects and mechanisms of USP29 on lipid metabolism and MASLD remain unclear.
Here, we identified USP29 as a significant negative regulator of MASLD progression. USP29 deficiency exacerbated hepatic steatosis, inflammation and fibrosis. However, USP29 overexpression had the opposite effect. Furthermore, USP29 significantly activated the expression of genes related to FAO under metabolic stimulation. Moreover, USP29 directly interacted with ACSL5 and stabilized ACSL5 via K48-linked deubiquitination. Moreover, the effect of USP29 on hepatocyte lipid accumulation and MASLD was dependent on ACSL5. These findings suggest that activating USP29-ACSL5 might be a promising therapeutic approach for MASLD.
MATERIALS AND METHODS
Human liver samples
Liver samples were randomly collected from individuals undergoing bariatric surgery. These samples were subjected to H&E staining and independently reviewed by two pathologists using standard histologic criteria to ensure unbiased selection and blinded scoring. Samples with a NAFLD activity score (NAS) of 0 were categorized as non-steatosis, those with a NAS of 1-2 but lacking ballooning or fibrosis were classified as simple steatosis, while those with a NAS of 5 or higher or a NAS of 3-4 accompanied by fibrosis were identified as MASH. All procedures involving the collection of human samples were approved by the Ethics Committee of ZhongNan Hospital of Wuhan University, and written informed consent was obtained from the subjects or their family members in accordance with the principles outlined in the Declaration of Helsinki.
Animal models and animal experiment management
Male C57bL/6J mice, aged 6 weeks, were purchased from Beijing Huafukang Biotechnology and adaptively bred for 2 weeks. To establish a MASLD model, the mice were subjected to a high-fat diet (HFD) feed (MD12032, 45% fat, 20% protein, 35% carbohydrate, Medicience, Nanjing, China) for 24 weeks. To establish a MASH model, the mice were fed a high fat and high cholesterol (HFHC) diet (IMA2019001, 42% fat, 14% protein, 44% carbohydrate, and 2% cholesterol, Trophic Diet, Nantong, China) for 16 weeks. The control group was fed a normal diet (1010086, 10% fat, 18% protein, and 72% carbohydrate, xietong, Nanjing, China) for the same duration. Another MASH model was established by feeding a methacholine-deficient diet (MCD, TP3005G, trophic diet, Nantong, China) diet for 4 weeks, while a methacholine-supplemented diet (MCS, TP3005GS, trophic diet, Nantong, China) diet was used as the control.
All mice were housed in the SPF animal room of the Animal Center, Institute of Cardiovascular Disease, Renmin Hospital of Wuhan University. The room temperature was maintained at 23±2℃, with a 12-hour day-night cycle, and water was freely available. All mouse experimental protocols were approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University and conformed to the relevant ethical guidelines.
Generation of genetically modified mice
USP29-KO mice were generated using the cas9 system. Initially, the CRISPR online design tools (http://chopchop.cbu.uib.no/) were used to predict the target gene DNA regions for the USP29 startup sequence of guideRNA target site (sgRNA1 TGATAATGTTACAGGCGTAGTGG and sgRNA2 AGTGGTATTCAGGGATCCACAGG). The in vitro transcripts of sgRNA expression vector and another expression vector were purified, mixed, and injected into single-cell fertilized eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. The fertilized eggs were then implanted into female mice acting as surrogates in order to generate F0 generation mice. PCR-positive mice were bred to generate USP29-KO mice, while littermate negative mice served as control animals. The primers were identified as primer-F (5’-3’)-TGGCTCACCTAAAGATAAATGG and primer-R (5’-3’)-TCACAGCTTTCTC TGCTTTG. To over-expression USP29 or ACSL 5, the 2*1011vg AAV8 in 100mL phosphate buffered saline (PBS) was injected via tail vein to Wide type mice or USP29-KO mice, the vector as a control.
Glucose tolerance (GTT) and insulin tolerance (ITT) tests
To determine GTT and ITT, mice were subjected to a 6-hour fasting period without access to water. Blood glucose levels were measured using a glucometer. Then intraperitoneal injections of glucose (1 g/kg) and insulin (0.75 IU/kg) were administered, respectively, and blood glucose levels were measured at 15 minutes, 30 minutes, 60 minutes, and 120 minutes post-injection.
Measurement of serum biochemistry and triglyceride content
Serum lipids including triglyceride, total cholesterol and low-density cholesterol, as well as liver function tests such as ALT and AST were detected by serum biochemical analyzer (HITACHI3110, Japan). The liver and cell triglycerides content were measured according to the instructions of the kit (A110-1-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
Histopathological analysis
Liver tissues were fixed in 10% formalin, dehydrated, embedded in paraffin, and cut into 5μm sections. Hematoxylin and eosin (H&E, Hematoxylin, G1004, Servicebio, Wuhan, China; Eosin, BA-4024, Baso, Zhuhai, China) staining was performed using a multi-function dyeing machine (ST5020-CV5030; Leica, Wetzler, Germany). The sections were dewaxed and hydrated before being stained with Sirius red staining (PSR) (26357-02; Hedebiotechnology, Beijing, China). Additionally, frozen liver tissue slices were also cut into 5 microns using a multi-function dyeing machine for oil red O staining (O0625; Sigma, St. Louis, MO, USA). For immunohistochemical analysis, the sections were subjected to antigen retrieval using EDTA. Endogenous catalase was inactivated with 3% H2O2, and then blocked with a 10% BSA (NA8692; Bomei Biotechnology, Hefei, China) solution at 37°C for 60 minutes. The primary antibody (USP29, 27522-1-AP, 1:100 dilution, Proteintech, Wuhan, China; ACSL5, A14130, 1:100 dilution, ABclonal, Wuhan, China; CD11B, BM3925, 1:4000 dilution, Boster, Wuhan, China) was added and incubated overnight at 4°C. Subsequently, the corresponding secondary antibody (PV-9001; ZSGB-BIO, Beijing, China) was incubated at 37°C for 30 minutes, followed by color development of immunohistochemistry using a DAB Color kit (BLRE079-200T; Biolight, China) according to the manufacturer’s instructions. Finally, the images were obtained either through a digital pathology scanner (Win180, WINMEDIC, Jinan, China) or microscopy (ECLIPSE 80i; Nikon, Tokyo, Japan).
Immunofluorescence analysis
For tissue immunofluorescence staining analysis, the sections were subjected to EDTA antigen retrieval and blocked with 10% BSA for 30 minutes at 37°C. The primary antibody (F4/80, GB11027, 1:1600 dilution, Servicebio, Wuhan, China; a-sma: ab5694, 1:200 dilution, abcam, Cambridge, UK) was added and incubated overnight at 4°C. Subsequently, the corresponding secondary antibodies were incubated at 37°C for 60 minutes. After sealing with slow fade gold anti-fade reagent containing DAPI (BMU107-CN; Abbkine, Wuhan, China), images were captured using a tissue cytometer analysis system (TissueFAXS Spectra, TissueGnostics, Austria) in a darkroom.
For cell immunofluorescence staining analysis, cells were fixed using 4% paraformaldehyde, permeabilized with 0.2% Triton for 10 minutes to enhance cell membrane permeability, and subsequently blocked with 10% BSA at 37°C for 60 minutes. The primary antibody (USP29, A16564, 1:100 dilution, ABclonal, Wuhan, China) was added and incubated overnight at 4°C. The corresponding secondary antibody was then incubated at 37°C for an additional 60 minutes, followed by nuclei staining with DAPI. Finally, the images were captured using a confocal laser scanning microscope (TCSSP8; Leica).
Primary cell isolation and culture
Primary cells were isolated from 6-8-week-old male C57BL/6J mice. After anesthetized, the mice were perfused with a sequential infusion of liver perfusion medium (17701-038; Thermo Fisher Scientific, Waltham, MA, USA) and liver digestion medium (17701-034; Thermo Fisher Scientific) via the portal vein. The well-digested liver tissue was collected into DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin, followed by filtration through a 70 μm cell strainer. Finally, after centrifugation at 50 g, the primary hepatocytes were obtained by resuspending the precipitate in DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin. At the same time, primary Kupffer cells and sinus endothelial cells were obtained from the supernatant by gradient centrifugation. All cells were cultured at 37℃ in an incubator containing 5% CO2.
Nile red staining
Primary hepatocyte cells were fixed with 4% paraformaldehyde solution, followed by staining with Nile red for lipid and DAPI for nuclear staining. The images were captured using a confocal laser scanning microscope (TCSSP8; Leica).
Western blot
Liver tissues and cells were effectively lysed using RIPA lysis buffer (65 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate and 0.1% SDS) supplemented with protease inhibitor (04693132001; Roche, Basel, BS, Switzerland) and phosphatase inhibitor (4906837001; Roche). Total protein was obtained from the supernatant by centrifugation at 12,000 rpm for 15 to 30 min at 4℃, and the concentration was determined using the BCA Protein Assay Kit (23225; Thermo, Waltham, MA, USA). The protein separation was performed using a 10% SDS-PAGE, followed by transfer onto a PVDF membranes (IPVH00010; Millipore, Billerica, MA, USA) and blocking with 5% skim milk in TBST. The PVDF membranes were incubated with the target primary antibody overnight at 4°C, followed by incubation with the appropriate HRP-conjugated secondary antibody for 1 hour at room temperature. Finally, the ECL kit (170-5061; Bio-Rad, Hercules, CA, USA) and the ChemiDoc MP imaging system (Bio-Rad) were utilized for image acquisition and quantitative analysis. The antibodies utilized are detailed in Supplementary Table 1.
Real-time fluorescence quantitative PCR (qPCR)
Total tissue and cells RNA was extracted using TRIzol reagent (T9424; Sigma, St. Louis, Missouri, USA). The first strand cDNA was synthesized according to the instructions of reverse transcription kit (R323-01; Vazyme, Nanjing, China).The qPCR analysis was performed using SYBR Green (Q111-02; Vazyme) on the LightCycler 480 system (Roche). The housekeeping gene β-Actin was used to quantify the relative expression levels of genes. Primer sequences used were shown in Supplementary Table 2.
Plasmid construction and adenovirus packaging
The full-length, truncated, and mutant USP29 and ACSL5 were amplified by PCR. Subsequently, the proper sequences were subcloned into the corresponding vectors to construct overexpression plasmids.
The full-length sequences of USP29 and ACSL5, as well as the shRNA sequence of ACSL5, were initially inserted into the shuttle vector pENTR-CMV. Subsequently, the target gene was recombined into the adenovirus vector pAd/PL-DEST to obtain the corresponding recombinant adenovirus plasmids. The recombinant adenovirus plasmids were transfected into 293A cells using the transfection reagent PEI Max in order to obtain the corresponding viruses. Subsequently, purification of the recombinant adenovirus was performed and its titer was determined using the plaque forming unit (PFU) method. Primers for plasmid construction were listed in Supplementary Table 3.
RNA-Seq analysis
The total RNA extracted was utilized for the construction of a cDNA library, which was subsequently sequenced on MGISEQ2000. Quality analysis of the original data sequence was performed with HISAT2, comparing and commenting with the mm10. Fasta and Mus_musculus. GRCm38.89. Protein coding. GTF databases. SAMtools and String Tie software were employed for data transformation and expression calculation, while DESeq2 was used for normalization and differential expression analysis.
Immunoprecipitation assays
The 293T cells transfected with the corresponding expression plasmids or primary hepatocytes infected with the corresponding virus were lysed with IP lysis buffer (20 mM Tris-HCl, pH 7.4; 150 mM NaCl; 1 mM EDTA; and 1% NP-40) containing cocktail. After centrifugation, the supernatant was retained. One portion of the supernatant was used as input quality control for WB analysis, and the other portion was incubated with beads washed by IP buffer and the indicated Agarose-anti-tag antibody beads overnight at 4°C. For endogenous IP, cells were immunoprecipitated with the indicated primary antibody. SDS loading was added and the mixture was mixed by centrifugation after denaturation at 95°C for 10 min. The beads were subjected to a NaCl wash followed by SDS loading, and subsequently denatured at 95°C for 10 minutes prior to analysis via Western blot.
GST-pull down assays
GST-HA-USP29, GST-HA-ACSL5, Flag-ACSL5 and Flag-USP29 were overexpressed in 293T cells for 24 h and lysed in a Lysis buffer (50mM Na2HPO4, pH 8.0; 300mM NaCl; 1% TritonX-100; cocktail). GST-HA-proteins were purified by GST beads, and Flag-proteins were de-hybridized with GST beads. Then the Flag-related supernatants were mixed with GST beads and incubated overnight. The beads were washed for 3 times with the buffer solution (20mM Tris-HCl, PH 6.8; 150mM NaCl; 0.2% TritonX-100). Finally, the proteins were detected by WB after boiling at 95°C for 5–10 min.
Immunoprecipitation-Mass spectrometry analysis
Primary hepatocytes were infected with USP29 overexpression adenovirus and control virus (GFP) and collected 12h after PAOA treatment. The cells were then immunoprecipitated using flag and separated by SDS-page, followed by silver staining. The adhesive strips were cut into small pieces for mass spectrometry analysis on the mass spectrometer (Orbitrap Eclipse Tribrid mass spectrometer, Thermo Fisher). The data obtained from mass spectrometry were analyzed using MaxQuant1.6.0.1 software.
In vivo ubiquitination assay
transfected cells were lysed in SDS lysis buffer (20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA and 1% SDS) and denatured by heating at 95°C. The samples were then diluted 10-fold with IP buffer and immunoprecipitated with the indicated antibodies. The anti-Myc, anti-ubiquitin, anti-K48-linked ubiquitin chains antibodies were used to analyze the ubiquitination of the immunoprecipitants.
Statistical analysis
All data were presented as the mean±SD using Prizm8.0 software. Statistical analysis was performed using SPSS software. When the data followed a normal distribution, a two-tailed Student’s t-test was employed to compare the data between two groups, while one-way ANOVA was utilized to compare the data among three or more groups. For ANOVA analysis, Bonferroni’s post hoc test was employed for assessing homogeneous data variances, while Tamhane’s T2 (M) post hoc test was utilized for evaluating heterogeneous data variances. The data that deviated from the normal distribution were subjected to analysis using nonparametric statistical tests.
RESULTS
USP29 expression is downregulated in the pathogenesis of MASLD
To investigate the potential role of USP29 in MASLD, we initially examined the expression of USP29 in the livers of MASLD model mice. The results revealed a significantly lower USP29 protein level in the livers of mice fed a high-fat diet (HFD) for 24 weeks than in those of mice fed normal chow (NC). Interestingly, the mRNA level of USP29 was not significantly different between the groups (Fig. 1A). Similar results were also found in the livers of mice fed a high-fat high-cholesterol (HFHC) diet or a methionine- and choline-deficient (MCD) diet (Fig. 1B, (C). Consistent with the results in mice, the protein level of USP29 in the livers of humans with MASLD was significantly lower than that in the livers of humans without MASLD (Fig. 1D). Furthermore, immunohistochemical staining analysis revealed a decrease in USP29 expression in hepatocytes (Fig. 1E), which was confirmed by the finding that the protein level of USP29 was markedly reduced in primary hepatocytes (Fig. 1F, Supplementary Fig. 1A) but not in sinusoidal endothelial cells or Kupffer cells following treatment with palmitic acid and oleic acid (PAOA) or lipopolysaccharide (LPS) (Supplementary Fig. 1B). Collectively, these data suggest that USP29 may participate in the pathogenesis of MASLD.
USP29 deletion exacerbates insulin resistance and hepatic steatosis induced by a HFD
To explore the potential role of USP29 in hepatic steatosis in MASLD, USP29 knockout (USP29-KO) mice were generated and fed a HFD for 24 weeks (Supplementary Fig. 2A). After 24 weeks of HFD feeding, compared with those of wild-type (WT) mice, the body weights and blood glucose levels of USP29-KO mice were significantly greater (Fig. 2A, B). Glucose tolerance and insulin sensitivity were also markedly impaired in USP29-KO mice (Fig. 2C, (D). Moreover, USP29-KO mice presented increases in liver weight, the liver weight-to-body weight ratio, white adipose weight, and the white adipose weight-to-body weight ratio (Fig. 2E, Supplementary Fig. 2C). Compared with WT mice, USP29-KO mice presented significantly elevated liver triglyceride (TG) and serum lipid contents, including TG, total cholesterol (TC) and low-density lipoprotein cholesterol (Fig. 2F, G). H&E and Oil Red O staining confirmed the increased severity of hepatic steatosis in HFD-fed USP29-KO mice (Fig. 2H). Moreover, the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were significantly increased in USP29-KO mice (Supplementary Fig. 2D). However, USP29-KO did not affect baseline metabolic characteristics. These results demonstrate that USP29 deletion exacerbates insulin resistance and hepatic steatosis induced by a HFD.
USP29 knockout accelerates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet
We further assessed the role of USP29 in MASH model mice induced by a HFHC diet, which exhibited a more obvious inflammatory response and fibrosis than did mice fed a HFD [23]. Consistent with the results for HFD-fed mice, after 16 weeks of HFHC diet feeding, compared with WT mice, USP29-KO mice presented significant increases in body weight and blood glucose and impaired glucose tolerance (Fig. 3A, B and Supplementary Fig. 3A). After 16 weeks of HFHC diet feeding, compared with WT mice, USP29-KO mice presented greater liver weights, liver weight-to-body weight ratios, white adipose weights, and white adipose weight-to-body weight ratios (Fig. 3C and Supplementary Fig. 3B, C). Moreover, after 16 weeks of HFHC diet feeding, USP29-KO mice presented more pronounced hepatic steatosis than did WT mice (Fig. 3D–F). Notably, compared with WT mice, USP29-KO mice presented increased inflammatory cell infiltration and more severe collagen deposition (Fig. 3G). Similarly, the serum ALT and AST levels were also significantly elevated in USP29-KO mice (Supplementary Fig. 3D). In conclusion, these results indicate that USP29 knockout accelerates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet.
USP29 overexpression alleviates hepatic steatosis, inflammation and fibrosis induced by a HFHC diet
To further confirm the effect of USP29 overexpression on HFHC diet-induced MASH in mice, we overexpressed USP29 by injecting AAV8-USP29, in parallel with a control, into C57BL/6J mice (Supplementary Fig. 4A). After being fed a HFHC diet, the USP29-overexpressing mice presented lower body weights and blood glucose levels than those of the controls (Supplementary Fig. 4B, C). Glucose tolerance was also improved by USP29 overexpression (Supplementary Fig. 4D, E). Moreover, the liver weights, white adipose weights, and ratio of liver weights or white adipose weights to body weights in USP29-overexpressing mice were markedly lower than those in controls (Supplementary Fig. 4F, G). Intriguingly, USP29 overexpression obviously attenuated hepatic steatosis, inflammation, collagen deposition and liver injury (Supplementary Fig. 4H–K). Together, these data suggest that USP29 overexpression ameliorates HFHC-induced MASH in mice.
USP29 alleviates hepatocyte lipid deposition and inflammation and promotes the fatty acid degradation pathway
Hepatocytes, the most important parenchymal cells in the liver, play a major role in a variety of liver diseases [24]. To further elucidate whether USP29 plays a key role in lipid deposition and inflammation in hepatocytes, mouse primary hepatocytes were isolated from USP29-KO mice and WT mice (Supplementary Fig. 5A). Nile red staining and triglyceride content analysis demonstrated that USP29 KO enhanced lipid deposition in cells stimulated with PAOA (Fig. 4A, B). Furthermore, we overexpressed USP29 in hepatocytes via infection with an adenovirus overexpressing USP29 (AdUSP29), with AdGFP used as a control (Supplementary Fig. 5B). Lipid accumulation was significantly lower in hepatocytes infected with AdUSP29 than in hepatocytes infected with AdGFP after treatment with PAOA (Fig. 4C, D).
To elucidate how USP29 regulates lipid metabolism in hepatocytes, RNA-Seq analysis was performed. GSEA was used to analyze the pathways that were reversely regulated due to abnormal USP29 expression. A Venn diagram revealed that 16 pathways were inhibited by USP29-KO but promoted by USP29 overexpression. Additionally, the fatty acid degradation pathway was most significantly enriched according to robust rank aggregation (Fig. 4E). In addition, we found that pathways related to inflammation were activated by USP29-KO but inhibited by USP29 overexpression (Fig. 4F). Representative genes related to fatty acid β-oxidation, such as carnitine palmitoyl transferase 1A (Cpt1a) and enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase (Ehhadh), and inflammation genes, such as C-C motif chemokine ligand 5 (Ccl5) and C-X-C motif chemokine ligand 2 (Cxcl2), were significantly affected by USP29 overexpression or knockout (Supplementary Fig. 5C, D). These results suggest that USP29 significantly alleviates PAOA-induced lipid accumulation and inflammation in hepatocytes and promotes the fatty acid degradation pathway.
USP29 interacts with ACSL5 and upregulates ACSL5 expression
To investigate the mechanism of USP29 in fatty acid degradation, co-immunoprecipitation mass spectrometry was performed to identify proteins that interact with USP29. Among more than 10 unique peptides in the USP29 overexpression group, three proteins associated with fatty acid degradation—aldehyde dehydrogenase 2 family member (ALDH2), acyl-CoA oxidase 1 (ACOX1) and long-chain acyl-CoA synthetase 5 (ACSL5)—were identified (Fig. 5A). The interaction between these three proteins and USP29 was confirmed by co-immunoprecipitation (co-IP) (Fig. 5B). However, western blot analysis revealed that only the ACSL5 protein level was significantly increased in hepatocytes infected with AdUSP29 under PAOA treatment (Fig. 5C).
ACSL5 is a key enzyme involved in fatty acid activation and has been reported to inhibit MASLD progression by promoting FAO [17]. Next, to test whether USP29 modulates MASLD via ACSL5, the effects of USP29 on ACSL5 were assessed. ACSL5 protein levels increased in a gradient-dependent manner with the overexpression of USP29 in PAOA-treated hepatocytes (Fig. 5D). In contrast, USP29 deficiency significantly reduced ACSL5 protein levels in both PAOA-treated hepatocytes and the livers of HFHC diet-fed mice (Fig. 5E, F). Furthermore, ACSL5 protein levels were noticeably lower in liver samples from humans with MASLD and in PAOA-treated hepatocytes than in the respective controls (Fig. 5G–I). Taken together, these results suggest that USP29 markedly upregulates ACSL5 expression.
The effect of USP29 on hepatocyte lipid accumulation and MASLD is dependent on ACSL5
To investigate whether the impact of USP29 on lipid accumulation in hepatocytes is dependent on ACSL5, we overexpressed ACSL5 in hepatocytes isolated from USP29-KO mice (Fig. 6A). Intriguingly, the overexpression of ACSL5 reversed the aggravated effects of USP29 knockout on lipid deposition in hepatocytes treated with PAOA (Fig. 6B, C). The expression of FAO-related (Cpt1a and Ehhadh) and inflammation-related (Cxcl2 and Ccl5) genes induced by USP29 knockout was significantly reversed by ACSL5 overexpression (Fig. 6D). Notably, ACSL5 knockdown markedly reversed the inhibitory effect of USP29 overexpression on hepatocytes treated with PAOA (Supplementary Fig. 6A–D).
To determine whether ACSL5 overexpression also reversed the role of USP29 knockout in MASLD in vivo, ACSL5 was overexpressed in USP29-KO mice by injecting AAV8-ACSL5 (Supplementary Fig. 7A). ACSL5 overexpression significantly attenuated the increased body weight, blood glucose and glucose tolerance induced by USP29 deletion (Supplementary Fig. 7B–D). Moreover, ACSL5 overexpression significantly reversed the increases in liver weights, the liver weight-to-body weight ratios and the levels of serum lipids in USP29-KO mice (Fig. 6E, F). Similarly, the increased white adipose weights, white adipose weight-to-body weight ratios and serum ALT and AST levels induced by USP29 deletion were also reversed by ACSL5 overexpression (Supplementary Fig. 7E, F). Intrigu-ingly, ACSL5 overexpression abolished the more severe hepatic steatosis, inflammation and collagen deposition induced by USP29 KO (Fig. 6G). Collectively, these results suggest that the effect of USP29 on MASLD is dependent on ACSL5.
USP29 directly interacts with ACSL5 and stabilizes ACSL5 through the suppression of K48-linked ubiquitination.
Next, we investigated the mechanism by which USP29 regulates ACSL5. First, the interaction between USP29 and ACSL5 was further confirmed by co-IP (Fig. 7A, B). Additionally, a GST pull-down assay revealed a direct interaction between USP29 and ACSL5 (Fig. 7C, D). Domain mapping analysis revealed that the USP domain of USP29 (aa 284–922) and the active region of ACSL5 (aa 1–571) mediate this interaction (Fig. 7E, F).
Furthermore, in the presence of the protein synthesis inhibitor cycloheximide (CHX), USP29 clearly extended the half-life of ACSL5 (Fig. 8A). Notably, the ubiquitination of ACSL5 was significantly decreased after USP29 overexpression but increased after USP29 KO (Fig. 8B, C). A screening assay for potential types of lysine ubiquitination revealed that USP29 significantly suppressed the K48-linked ubiquitination of ACSL5 (Fig. 8D). Consistently, we found that USP29 KO promoted the K48-linked ubiquitination of ACSL5 (Fig. 8E). Interestingly, compared with wildtype USP29, mutated USP29 (C298A) did not effectively inhibit the degradation of ACSL5 or hepatocyte lipid deposition (Fig. 8F–I). Taken together, these data suggest that USP29 stabilizes ACSL5 through the suppression of K48 ubiquitination, which is dependent on the USP domain of USP29.
DISCUSSION
The present study revealed a novel role of USP29 in MASLD. Specifically, diet-induced hepatic steatosis, inflammation and fibrosis were significantly exacerbated by USP29 deletion and relieved by USP29 overexpression. USP29 can protect itself from degradation through self-deubiquitination, which is dependent on its N-terminal region [25]. Our study demonstrated that the protein level, rather than the mRNA level, of USP29 was significantly decreased in mice and humans with MASLD. Therefore, we speculate that a pivotal molecule binds to the N-terminus of USP29 to impede its self-deubiquitination under the pathological conditions associated with MASLD, which needs to be tested in future studies.
Extensive research indicates that the downregulation of fatty acid oxidation is correlated with increased MASLD severity [12,26]. In the present study, we found that USP29 significantly activated the expression of genes involved in FAO, such as Cpt1a and Ehhadh. Furthermore, we found that USP29 directly interacted with ACSL5 and upregulated ACSL5 expression. Moreover, the overexpression of ACSL5 reversed the effect of USP29 KO on MASLD and the expression of genes involved in FAO. These data suggest that USP29 mediated MASLD by stabilizing ACSL5 and further activating FAO. The fatty acid oxidation process is complex and involves multiple key enzymes and transcription factors [27,28]. As a rate-limiting enzyme in the initial stage of fatty acid oxidation, ACSLs activate long-chain fatty acids to produce acyl-CoAs, which are directed to the mitochondria for β-oxidation [29]. It has been shown that the activation of ACSL5 ameliorates MASLD by increasing fatty acid β-oxidation [17,30,31]. Peroxisome proliferator-activated receptor α (PPARα) is a core transcription factor that mainly regulates key enzymes involved in FAO. The transcriptional activity of PPARα is regulated by its ligands, such as fatty acids and metabolites produced from the fatty acid metabolic pathway [32,33]. Together, in the present study, the regulatory effect of USP29-ACSL5 on the expression of genes involved in FAO may have occurred because, under metabolic stimulation, USP29 stabilized ACSL5 expression to promote the activation of fatty acids, which in turn activated PPARa to induce the expression of genes involved in FAO and then directed them to the mitochondria for β-oxidation. This needs to be further demonstrated in future studies.
The expression of ACSL5 is regulated at the transcriptional level by a variety of metabolic factors, such as SREBP-1C and HNF4 [34,35]. Our study revealed that the expression of ACSL5 was also regulated through ubiquitination. These findings provide a novel potential strategy for stabilizing ACSL5 in the liver as a viable approach to prevent MASLD.
USPs constitute the largest family of deubiquitinating enzymes and play a key role in maintaining protein homeostasis and disease [36,37]. As a typical USP, the deubiquitinating enzymatic activity of USP29 is dependent on the integrity of its C-terminal USP domain [22,38-40]. Consistent with these findings, our results revealed that the effect of USP29 on hepatocyte lipid deposition is dependent on its USP domain.
The pathogenesis of MASLD involves multiple cell types, with hepatocytes assuming a pivotal role as the principal constituents within hepatic tissue [41]. In the present study, the USP29 protein level was decreased in hepatocytes, and deletion of USP29 significantly aggravated lipid accumulation in hepatocytes and hepatic steatosis under metabolic stimulation. Moreover, AAV8-mediated USP29 expression effectively alleviated MASLD progression. These findings suggest that the regulation of MASLD by USP29 was mediated through hepatocytes. However, whether USP29 can also affect MASLD by regulating other cells needs to be further investigated.
In conclusion, we identified USP29 as a novel negative regulator of MASLD progression. More importantly, our results suggest novel mechanisms by which USP29 alleviates MASLD by stabilizing ACSL5 and further activating FAO. Thus, targeting USP29-ACSL5 may constitute an effective therapeutic strategy for MASLD.
PDF Links
PubReader
ePub Link
XML Download
Full text via DOI
Download Citation
Supplement1
Print
